Review



recombinant g6pd  (R&D Systems)


Bioz Verified Symbol R&D Systems is a verified supplier
Bioz Manufacturer Symbol R&D Systems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    R&D Systems recombinant g6pd
    Recombinant G6pd, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant g6pd/product/R&D Systems
    Average 94 stars, based on 2 article reviews
    recombinant g6pd - by Bioz Stars, 2026-03
    94/100 stars

    Images



    Similar Products

    recombinant g6pd  (R&D Systems)
    94
    R&D Systems recombinant g6pd
    Recombinant G6pd, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant g6pd/product/R&D Systems
    Average 94 stars, based on 1 article reviews
    recombinant g6pd - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    recombinant proteins ag 1 medchem express  (MedChemExpress)
    94
    MedChemExpress recombinant proteins ag 1 medchem express
    Recombinant Proteins Ag 1 Medchem Express, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant proteins ag 1 medchem express/product/MedChemExpress
    Average 94 stars, based on 1 article reviews
    recombinant proteins ag 1 medchem express - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    g9391 g6pd recombinant r d systems  (R&D Systems)
    94
    R&D Systems g9391 g6pd recombinant r d systems
    G9391 G6pd Recombinant R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/g9391 g6pd recombinant r d systems/product/R&D Systems
    Average 94 stars, based on 1 article reviews
    g9391 g6pd recombinant r d systems - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    oligonucleotides g6pd forward sigma agctggaggacttctttgcc g6pd reverse sigma tgatgcggttccagcctatc recombinant dna pet21a alpha synuclein addgene  (Addgene inc)
    93
    Addgene inc oligonucleotides g6pd forward sigma agctggaggacttctttgcc g6pd reverse sigma tgatgcggttccagcctatc recombinant dna pet21a alpha synuclein addgene
    Oligonucleotides G6pd Forward Sigma Agctggaggacttctttgcc G6pd Reverse Sigma Tgatgcggttccagcctatc Recombinant Dna Pet21a Alpha Synuclein Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligonucleotides g6pd forward sigma agctggaggacttctttgcc g6pd reverse sigma tgatgcggttccagcctatc recombinant dna pet21a alpha synuclein addgene/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    oligonucleotides g6pd forward sigma agctggaggacttctttgcc g6pd reverse sigma tgatgcggttccagcctatc recombinant dna pet21a alpha synuclein addgene - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    recombinant peptide fragment of g6pd with phosphorylation at thr-91 antibody  (GenScript corporation)
    90
    GenScript corporation recombinant peptide fragment of g6pd with phosphorylation at thr-91 antibody
    Recombinant Peptide Fragment Of G6pd With Phosphorylation At Thr 91 Antibody, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant peptide fragment of g6pd with phosphorylation at thr-91 antibody/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    recombinant peptide fragment of g6pd with phosphorylation at thr-91 antibody - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    recombinant human g6pd protein  (R&D Systems Hematology)
    90
    R&D Systems Hematology recombinant human g6pd protein
    Recombinant Human G6pd Protein, supplied by R&D Systems Hematology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant human g6pd protein/product/R&D Systems Hematology
    Average 90 stars, based on 1 article reviews
    recombinant human g6pd protein - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    recombinant g6pd enzyme cat# 078a0020  (Calzyme Laboratories)
    90
    Calzyme Laboratories recombinant g6pd enzyme cat# 078a0020
    The PreQuine Platform consists of the following (1) Blood collection kits with single-use, fixed-volume pipettes, (2) Lysis buffer, (3) Handheld reflectance-based meter, (4) Cell phone application, and (5) Test strips for <t>G6PD</t> and Hgb detection.
    Recombinant G6pd Enzyme Cat# 078a0020, supplied by Calzyme Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant g6pd enzyme cat# 078a0020/product/Calzyme Laboratories
    Average 90 stars, based on 1 article reviews
    recombinant g6pd enzyme cat# 078a0020 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    recombinant glucose-6-phosphate dehydrogenase (g6pd) leuconostoc mesenteroides  (Millipore)
    90
    Millipore recombinant glucose-6-phosphate dehydrogenase (g6pd) leuconostoc mesenteroides
    The PreQuine Platform consists of the following (1) Blood collection kits with single-use, fixed-volume pipettes, (2) Lysis buffer, (3) Handheld reflectance-based meter, (4) Cell phone application, and (5) Test strips for <t>G6PD</t> and Hgb detection.
    Recombinant Glucose 6 Phosphate Dehydrogenase (G6pd) Leuconostoc Mesenteroides, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant glucose-6-phosphate dehydrogenase (g6pd) leuconostoc mesenteroides/product/Millipore
    Average 90 stars, based on 1 article reviews
    recombinant glucose-6-phosphate dehydrogenase (g6pd) leuconostoc mesenteroides - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    recombinant dna rat g6pd (nm_017006.2) in pcdna3.1+/c-(k)-dyk  (GenScript corporation)
    90
    GenScript corporation recombinant dna rat g6pd (nm_017006.2) in pcdna3.1+/c-(k)-dyk
    The PreQuine Platform consists of the following (1) Blood collection kits with single-use, fixed-volume pipettes, (2) Lysis buffer, (3) Handheld reflectance-based meter, (4) Cell phone application, and (5) Test strips for <t>G6PD</t> and Hgb detection.
    Recombinant Dna Rat G6pd (Nm 017006.2) In Pcdna3.1+/C (K) Dyk, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant dna rat g6pd (nm_017006.2) in pcdna3.1+/c-(k)-dyk/product/GenScript corporation
    Average 90 stars, based on 1 article reviews
    recombinant dna rat g6pd (nm_017006.2) in pcdna3.1+/c-(k)-dyk - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    The PreQuine Platform consists of the following (1) Blood collection kits with single-use, fixed-volume pipettes, (2) Lysis buffer, (3) Handheld reflectance-based meter, (4) Cell phone application, and (5) Test strips for G6PD and Hgb detection.

    Journal: PLOS ONE

    Article Title: The PreQuine Platform: A novel diagnostic tool for measuring glucose-6-phosphate dehydrogenase (G6PD) activity and hemoglobin concentration

    doi: 10.1371/journal.pone.0297918

    Figure Lengend Snippet: The PreQuine Platform consists of the following (1) Blood collection kits with single-use, fixed-volume pipettes, (2) Lysis buffer, (3) Handheld reflectance-based meter, (4) Cell phone application, and (5) Test strips for G6PD and Hgb detection.

    Article Snippet: G6PD enzyme activity was adjusted via freeze/thaw cycles and/or spiking with recombinant G6PD enzyme (Cat# 078A0020, Calzyme, San Luis Obispo, CA) while Hgb levels were adjusted through the addition and subtraction of plasma.

    Techniques: Lysis

    a) Exploded view of the G6PD dual analyte test strip. (1) a spreading layer (transport membrane), (2) a G6PD reagent membrane (hollow fiber membrane with electron mediator, inhibitor, and substrate), (3) a G6PD detection membrane (mixed mesh < 1 μm) facing the LED, (4) a reagent membrane (polyether sulfone membrane containing sodium azide and sodium nitrite) and (5) an optical membrane (polyether sulfone membrane < 1 μm) facing the LED. b) Top and bottom view of the fully assembled test strip with representative color change after test strip chemical reaction (far right). c) PreQuine Platform’s reflectance-based meter shows both 570 and 670 nm LEDs that are used for the simultaneous detection of Hgb and G6PD, respectively.

    Journal: PLOS ONE

    Article Title: The PreQuine Platform: A novel diagnostic tool for measuring glucose-6-phosphate dehydrogenase (G6PD) activity and hemoglobin concentration

    doi: 10.1371/journal.pone.0297918

    Figure Lengend Snippet: a) Exploded view of the G6PD dual analyte test strip. (1) a spreading layer (transport membrane), (2) a G6PD reagent membrane (hollow fiber membrane with electron mediator, inhibitor, and substrate), (3) a G6PD detection membrane (mixed mesh < 1 μm) facing the LED, (4) a reagent membrane (polyether sulfone membrane containing sodium azide and sodium nitrite) and (5) an optical membrane (polyether sulfone membrane < 1 μm) facing the LED. b) Top and bottom view of the fully assembled test strip with representative color change after test strip chemical reaction (far right). c) PreQuine Platform’s reflectance-based meter shows both 570 and 670 nm LEDs that are used for the simultaneous detection of Hgb and G6PD, respectively.

    Article Snippet: G6PD enzyme activity was adjusted via freeze/thaw cycles and/or spiking with recombinant G6PD enzyme (Cat# 078A0020, Calzyme, San Luis Obispo, CA) while Hgb levels were adjusted through the addition and subtraction of plasma.

    Techniques: Stripping Membranes, Membrane

    a) G6PD assay reaction mechanism. b) PreQuine Platform’s unique indicator showing free of interference with Bilirubin and Hemoglobin.

    Journal: PLOS ONE

    Article Title: The PreQuine Platform: A novel diagnostic tool for measuring glucose-6-phosphate dehydrogenase (G6PD) activity and hemoglobin concentration

    doi: 10.1371/journal.pone.0297918

    Figure Lengend Snippet: a) G6PD assay reaction mechanism. b) PreQuine Platform’s unique indicator showing free of interference with Bilirubin and Hemoglobin.

    Article Snippet: G6PD enzyme activity was adjusted via freeze/thaw cycles and/or spiking with recombinant G6PD enzyme (Cat# 078A0020, Calzyme, San Luis Obispo, CA) while Hgb levels were adjusted through the addition and subtraction of plasma.

    Techniques: G6PD Assay

    The performance comparison of the PreQuine Platform to measure the activity of the G6PD enzyme compared with the Pointe Scientific method measured by the spectrophotometer (Pointe Scientific reagents) in U/g Hgb.

    Journal: PLOS ONE

    Article Title: The PreQuine Platform: A novel diagnostic tool for measuring glucose-6-phosphate dehydrogenase (G6PD) activity and hemoglobin concentration

    doi: 10.1371/journal.pone.0297918

    Figure Lengend Snippet: The performance comparison of the PreQuine Platform to measure the activity of the G6PD enzyme compared with the Pointe Scientific method measured by the spectrophotometer (Pointe Scientific reagents) in U/g Hgb.

    Article Snippet: G6PD enzyme activity was adjusted via freeze/thaw cycles and/or spiking with recombinant G6PD enzyme (Cat# 078A0020, Calzyme, San Luis Obispo, CA) while Hgb levels were adjusted through the addition and subtraction of plasma.

    Techniques: Comparison, Activity Assay, Spectrophotometry

    3rd order polynomial relationship between known values of G6PD/mL and percent reflectance values (derived from PreQuine G6PD assay) for G6PD-adjusted blood samples.

    Journal: PLOS ONE

    Article Title: The PreQuine Platform: A novel diagnostic tool for measuring glucose-6-phosphate dehydrogenase (G6PD) activity and hemoglobin concentration

    doi: 10.1371/journal.pone.0297918

    Figure Lengend Snippet: 3rd order polynomial relationship between known values of G6PD/mL and percent reflectance values (derived from PreQuine G6PD assay) for G6PD-adjusted blood samples.

    Article Snippet: G6PD enzyme activity was adjusted via freeze/thaw cycles and/or spiking with recombinant G6PD enzyme (Cat# 078A0020, Calzyme, San Luis Obispo, CA) while Hgb levels were adjusted through the addition and subtraction of plasma.

    Techniques: Derivative Assay, G6PD Assay

    The first order linear regression relationship between U/dL values as measured by the Spectrophotometer (Pointe Scientifique) and as measured and derived by the PreQuine G6PD assay.

    Journal: PLOS ONE

    Article Title: The PreQuine Platform: A novel diagnostic tool for measuring glucose-6-phosphate dehydrogenase (G6PD) activity and hemoglobin concentration

    doi: 10.1371/journal.pone.0297918

    Figure Lengend Snippet: The first order linear regression relationship between U/dL values as measured by the Spectrophotometer (Pointe Scientifique) and as measured and derived by the PreQuine G6PD assay.

    Article Snippet: G6PD enzyme activity was adjusted via freeze/thaw cycles and/or spiking with recombinant G6PD enzyme (Cat# 078A0020, Calzyme, San Luis Obispo, CA) while Hgb levels were adjusted through the addition and subtraction of plasma.

    Techniques: Spectrophotometry, Derivative Assay, G6PD Assay